null

Recently Viewed

New

Creation: The Origin of Life / The Future of Life by Adam Rutherford

No reviews yet Write a Review
RRP: €13.08
€9.25
Booksplease saves you

  Delivery: We ship to over 200 countries from the UK
  Range: Millions of books available
  Reviews: Booksplease rated "Excellent" on Trustpilot

  FREE UK DELIVERY: When you buy 3 or more books on Booksplease - Use code: FREEUKDELIVERY in your cart!

SKU:
9780241954690
MPN:
9780241954690
Available from Booksplease!
Availability: Usually dispatched within 2 working days

Frequently Bought Together:

Total: Inc. VAT
Total: Ex. VAT

Description

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.

'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday

The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.

'A superbly written explanation' Brian Cox

This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.

'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph

'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer

'The perfect primer on the past and future of DNA' Guardian

'Susenseful, erudite and thrilling' Prospect

'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain

'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili

'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times

'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk

'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts

'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome

'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times

Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG



Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.


About the Author
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.

Reviews
Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller * Mail on Sunday *
One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet * Observer *
Fascinating. The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny * Sunday Telegraph *
The perfect primer on the past and future of DNA * Guardian *



Book Information
ISBN 9780241954690
Author Adam Rutherford
Format Paperback
Page Count 272
Imprint Penguin Books Ltd
Publisher Penguin Books Ltd
Weight(grams) 191g
Dimensions(mm) 198mm * 129mm * 17mm

Reviews

No reviews yet Write a Review

Booksplease  Reviews


J - United Kingdom

Fast and efficient way to choose and receive books

This is my second experience using Booksplease. Both orders dealt with very quickly and despatched. Now waiting for my next read to drop through the letterbox.

J - United Kingdom

T - United States

Will definitely use again!

Great experience and I have zero concerns. They communicated through the shipping process and if there was any hiccups in it, they let me know. Books arrived in perfect condition as well as being fairly priced. 10/10 recommend. I will definitely shop here again!

T - United States

R - Spain

The shipping was just superior

The shipping was just superior; not even one of the books was in contact with the shipping box -anywhere-, not even a corner or the bottom, so all the books arrived in perfect condition. The international shipping took around 2 weeks, so pretty great too.

R - Spain

J - United Kingdom

Found a hard to get book…

Finding a hard to get book on Booksplease and with it not being an over inflated price was great. Ordering was really easy with updates on despatch. The book was packaged well and in great condition. I will certainly use them again.

J - United Kingdom